SGN Marker T1321

SGN-M1925
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAN12TH
Arabidopsis best BAC match: AL031018.1
Arabidopsis position: 4.1180000
Arabidopsis identities: 0.676
Best GenBank protein hit: CAB79258.1
Evalue: 1.3e-51
Identities: 0.676
Description: putative protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39577)
Chromosome
3
Position
59.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1321 was used as an overgo probe on plate 7 [well A5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CATCCCAAGCTGCATTGCAGTATG
B sequence
CCACCACCATTCAAGACATACTGC
AB sequence
CATCCCAAGCTGCATTGCAGTATGTCTTGA
Marker sequence
TCGCCCAATCTTTACTTCATCCCTTGCGTATTTACCTTAGAACTCAATCG
ATTACTCTGCCTCTGACTTGTTGTGCGATTTTCGCCATTCTCCTGCATAT
ACCCATAAATTTTCTTCTTGTTATCAAGCTTAATTTGGGGGTTAGAGGAG
TTGCTATGAGTGGGGTTTTGACTAATTTTAATCTAGTAGGTTCGTGGATT
GTATATATTCTTGTTTCTGGGGTTTACAAAAAGACATGGGAGAAATTGCC
AATGGAGTGTGTTAAAGGATGGAAATCCCTTTTGAATGTAGCCATCCCAA
GCTGCATTGCAGTATGTCTTGAATGGTGGTGGTATGAGATCATGATTGTG
CTCTGTGGGTTGTCGATTAACCCGAAAGCAACGGTTGCTTCAATGGGCAT
TATGAT
Genomic location of T1321  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1925 marker 1925
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)