SGN Marker solcap_snp_sl_14860

SGN-M19273

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71003)
Chromosome
10
Position
45.76 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67374)
Chromosome
10
Position
52.84 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55604)
Chromosome
10
Position
60.70 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATTGGTACTCCCATTGATATACTCTCCATACACGAATTCCACCCGCAATG
  
3' flanking region
CTCATGAATCCACCCGTCGACTCGTGTCCCAATATCTCCAATTGTGGTGC
SNP nucleotide
AG
SNPdb format
ATTGGTACTCCCATTGATATACTCTCCATACACGAATTCCACCCGCAATG[A/G]
CTCATGAATCCACCCGTCGACTCGTGTCCCAATATCTCCAATTGTGGTGC
  
Genomic location of solcap_snp_sl_14860  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19273 marker 19273
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)