SGN Marker solcap_snp_sl_14868

SGN-M19280

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71007)
Chromosome
10
Position
45.76 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67377)
Chromosome
10
Position
52.84 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63816)
Chromosome
10
Position
82.69 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55611)
Chromosome
10
Position
60.74 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GAAAGGGGGATTTTGGTAAGAGATTGGGCACCTCAATTGGAGATCTTGTC
  
3' flanking region
CATTGTTCGACTGGTGGATTCTTGAGTCACTGTGGGTGGAATTCATGCAT
SNP nucleotide
AG
SNPdb format
GAAAGGGGGATTTTGGTAAGAGATTGGGCACCTCAATTGGAGATCTTGTC[A/G]
CATTGTTCGACTGGTGGATTCTTGAGTCACTGTGGGTGGAATTCATGCAT
  
Genomic location of solcap_snp_sl_14868  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19280 marker 19280
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)