SGN Marker solcap_snp_sl_14875

SGN-M19284

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71009)
Chromosome
10
Position
46.58 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67378)
Chromosome
10
Position
52.84 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63817)
Chromosome
10
Position
82.69 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55615)
Chromosome
10
Position
60.86 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CAGGAAAGTGAGACCAAACATCTTGATCAAGTGTAGGAGCGAATATCCTC
  
3' flanking region
GTCAAAACTTGAAAATGTAATTTTGGCGGGGAAAGCAAGTCTCTAACAAC
SNP nucleotide
AG
SNPdb format
CAGGAAAGTGAGACCAAACATCTTGATCAAGTGTAGGAGCGAATATCCTC[A/G]
GTCAAAACTTGAAAATGTAATTTTGGCGGGGAAAGCAAGTCTCTAACAAC
  
Genomic location of solcap_snp_sl_14875  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19284 marker 19284
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)