SGN Marker solcap_snp_sl_14880

SGN-M19288

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67380)
Chromosome
10
Position
52.84 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63819)
Chromosome
10
Position
82.69 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55619)
Chromosome
10
Position
60.87 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTCTGCCATCATCTCGCTTTTCATCGTCATCATCCTTCCCGAAACCAAC
  
3' flanking region
GGGTTATACAAGGATCCAAACAATAAGTTCTCAAGCTTCTCCATTTCCTG
SNP nucleotide
AT
SNPdb format
TTTCTGCCATCATCTCGCTTTTCATCGTCATCATCCTTCCCGAAACCAAC[A/T]
GGGTTATACAAGGATCCAAACAATAAGTTCTCAAGCTTCTCCATTTCCTG
  
Genomic location of solcap_snp_sl_14880  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19288 marker 19288
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)