SGN Marker solcap_snp_sl_14881

SGN-M19289

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71011)
Chromosome
10
Position
46.58 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55620)
Chromosome
10
Position
60.87 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTGAACCAACAATGTACTTTGTTGCCATTCTTGAACTCCAACAGCTAAAA
  
3' flanking region
ATTATCTAAAACACAGTGAGACAGTAATTTGAGTGCTTTAAGAATAGAAA
SNP nucleotide
AG
SNPdb format
CTGAACCAACAATGTACTTTGTTGCCATTCTTGAACTCCAACAGCTAAAA[A/G]
ATTATCTAAAACACAGTGAGACAGTAATTTGAGTGCTTTAAGAATAGAAA
  
Genomic location of solcap_snp_sl_14881  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19289 marker 19289
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)