SGN Marker T1327

SGN-M1929
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAN30TH
Arabidopsis best BAC match: AC023628.3
Arabidopsis position: 1.0015000
Arabidopsis identities: 0.801
Best GenBank protein hit: AAF97328.1
Evalue: 1.3e-74
Identities: 0.746
Description: Unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39580)
Chromosome
1
Position
90.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1327 was used as an overgo probe on plate 9 [well E1]

Plausible BAC Matches:   P175E23,   P276M05,   P276N05

 Overgo Sequences

A sequence
GACCCGAGTAAATCGTCTTCCTTC
B sequence
CACATGCAACACCAAGGAAGGAAG
AB sequence
GACCCGAGTAAATCGTCTTCCTTCCTTGGT
Marker sequence
GGGGAAGTGACGTCGTTTGGATCCAGTGTTCGCCTTGTAAAAAGTGCTAC
ACTCAATCCGACCCGGTTTTTGACCCGAGTAAATCGTCTTCCTTCCTTGG
TGTTGCATGTGGGTCGCCTTTGTGTCGCCGGTTGGATTCTGGTAGCTGTA
ACCGAAAGAAATGTCTTTATCAGGTTTCTTACGGAGACGGTTCTTTCACC
GTCGGCGATTTTTCAACTGAAACGTTAACTTTCAGGGGCACACGCGTGAA
CAACGTGGCCCTTGGATGCGGCCACGATAACGAAGGTTTATTCGTCGGAG
CTGCTGGTTTACTGGGTCTCGGCCGGGGTAGACTATCATTTCCGACTCAA
GCTGGTCGGAGATTCGGCAGAAAATTCTCCTACTGCCTTGTCGACCGGTC
CGCTTCCTCTAAACCATCCTATCTAGTCTTCGGCGAATCTGCAGTTTCTC
GAACCGCTGTGTTTACCCCACTCGTGAAAAACCCAAAACTAGACACGTTC
TACTACGTGGAGCTCACCGGATTCAGCGTCGGCGGCGCTAGGGTTCCTGC
AATCAGGCCCTCGCTGTTCAAGCTA
Genomic location of T1327  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1929 marker 1929
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)