SGN Marker solcap_snp_sl_14890

SGN-M19293

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71014)
Chromosome
10
Position
46.85 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67381)
Chromosome
10
Position
52.84 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63820)
Chromosome
10
Position
83.37 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55624)
Chromosome
10
Position
60.92 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TAACCAACCACTTTGGTATCTGTTAGTCCACCAACATGACTATGAGTAAT
  
3' flanking region
CGACTATTGAAACTGAAGATACTTTTGCCAGCTTGCTTGAACTTGCTGCC
SNP nucleotide
TC
SNPdb format
TAACCAACCACTTTGGTATCTGTTAGTCCACCAACATGACTATGAGTAAT[T/C]
CGACTATTGAAACTGAAGATACTTTTGCCAGCTTGCTTGAACTTGCTGCC
  
Genomic location of solcap_snp_sl_14890  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19293 marker 19293
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)