SGN Marker TG551

SGN-M193

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
950
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AATGAAGTTCAGTTGATAAGCTAAATGGTGGAAATACTAATTTTAATTGACAGTAACTTTGCATTTCAAGGTCCATACCAAAACATTTGC
TAACACCAGTTGCTTTGTCAACGAAAACCTTGGCACTCAAAACCCTACCAAAAGGCTGAAATGCATTTGCAAGCTCTTGATCACCAAATT
CTTGAGGAATATGGTAAATAAATAGATTAGCACCAGGTGGACCTGTAAACAGCAAAATCGTTTTTGATAAGTACAGGTTTATTTCTACAT
GTTCAACTACCACTGCCAAGTACACTAGTTCAAGTGACATCTCCACCACTTAATTGCATAAAGCTTTACCAACGACAAATATAACAAACT
TGTGCAAGTAATTTGAGTTCCTGTCTATACAGTCCAGAATCTCCATATGCTGCTCATCTCACAATGTTGGTTAAGGAAATTTGTCAAGTA
AAGTTCAA
Reverse sequence
CATCTTCAAGTGTCAGCTCAAGTACAGGGGGTCAGGTTGAAGGTTGTTGAACATTTATTTTGTGACCTTTTTAGCTCTAGAATTTCTGTA
GCTAATCAAGTACAGTCCCATAACCTAGGGGCTGTTAGGGTTTTCTGCTGAATGAGGCTGCTTGTCTTTATTTTGGTTAATTATTTTCTG
GAAATTGTTCCTCGTCATAGAGAATAGAAGTAGAAGAAGAAGAAGATAGTATAATCTATTATATTTGTTTTTTACTTAATTTATAAAGAT
TCCATAAATGCATGTGATCTTTGATCAATGATATCTTATACAAGTGTATCACTAGAATCTATTATATTTGGATTTACTTATTTTATATAG
GATTTCATAAACGCATGTGATC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43879)
Chromosome
9
Position
44.90 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43618)
Chromosome
9
Position
54.10 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43341)
Chromosome
9
Position
60.20 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40884)
Chromosome
9
Position
65.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40083)
Chromosome
9
Position
56.70 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8526)
Chromosome
9
Position
61.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8530)
Chromosome
9
Position
71.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG551 was used as an overgo probe on plate 15 [well A10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GCTAACACCAGTTGCTTTGTCAAC
B sequence
GAGTGCCAAGGTTTTCGTTGACAA
AB sequence
GCTAACACCAGTTGCTTTGTCAACGAAAAC
Marker sequence
AATGAAGTTCAGTTGATAAGCTAAATGGTGGAAATACTAATTTTAATTGA
CAGTAACTTTGCATTTCAAGGTCCATACCAAAACATTTGCTAACACCAGT
TGCTTTGTCAACGAAAACCTTGGCACTCAAAACCCTACCAAAAGGCTGAA
ATGCATTTGCAAGCTCTTGATCACCAAATTCTTGAGGAATATGGTAAATA
AATAGATTAGCACCAGGTGGACCTGTAAACAGCAAAATCGTTTTTGATAA
GTACAGGTTTATTTCTACATGTTCAACTACCACTGCCAAGTACACTAGTT
CAAGTGACATCTCCACCACTTAATTGCATAAAGCTTTACCAACGACAAAT
ATAACAAACTTGTGCAAGTAATTTGAGTTCCTGTCTATACAGTCCAGAAT
CTCCATATGCTGCTCATCTCACAATGTTGGTTAAGGAAATTTGTCAAGTA
AAGTTCAA
Genomic location of TG551  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D193 marker 193
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)