SGN Marker T1328

SGN-M1930
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.13.01
Tomato EST read: TPTAN34TH
Arabidopsis best BAC match: AL049657.1
Arabidopsis position: 4.1260000
Arabidopsis identities: 0.879
Best GenBank protein hit: CAB79392.1
Evalue: 2.0e-86
Identities: 0.750
Description: putative proteasome regulatory subunit [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49422)
Chromosome
7
Position
4.16 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47356)
Chromosome
7
Position
17.34 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39581)
Chromosome
7
Position
13.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1328 was used as an overgo probe on plate 8 [well C5]

Plausible BAC Matches:   P230E07

 Overgo Sequences

A sequence
AGTCTTGGAAGCTGTGGTCTCCAA
B sequence
CAACGGAGCCATATCATTGGAGAC
AB sequence
AGTCTTGGAAGCTGTGGTCTCCAATGATAT
Marker sequence
TAGTGAAACCTTTGAGAGAGAACTATGGATTCGGAAGAAGGAACCCAGCA
ACCCCAGCTAGTTCTTGCACACAAACTATTCCTTTTGACACATCCAGATG
TCAATGACTTGGATAAAGTTCGTCTTCGTGAAGAAGTCTTGGAAGCTGTG
GTCTCCAATGATATGGCTCCGTTGTTTGAAACCCTAGTTTCAAAAGGGGT
TTTTAGTTTGAATCTGGAGGTTCTTGATCCTATGCGTGTTAAGAATGCTG
ATGAGCTTAAAAAACTCGATGAGAAGATTGCTGATGCAGAAGAAAATCTT
GGTGAAAGTGAAGTTCGAGAAGCTCATTTGGCTAAATCATTGTTCTACAT
TAGGATTGGTGACAAGGGGAAAGCACTTGAACAACTCAAGGTGACTGAGA
AAAAAACTGTTGCAGTTGGGCAAAAGATGGACCTGGTGTTCTATACCTTG
CAGATGGGATTATTTGACTTGGATTTTGACCTCATCTCTAAATGCATAGA
TAAGGCAAAGAAATTATTTGAAAAGGGGGGTGACTGGGAGAGAAAGAACA
GGTTGAAGGTGTATGAAAGGTTGTTCTGCATGTCCACTCGTAACTTCAAG
AAAGCAGCAGATCTTTTCCTTGATTCTATCTCAACTTTTACCACATATGA
GCTTTTCCCCTATGATACTTTCATATTTTATACTG
Genomic location of T1328  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1930 marker 1930
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)