SGN Marker T1329

SGN-M1931
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.1
Tomato EST read: TPTAN41TH
Arabidopsis best BAC match: AL035440.2
Arabidopsis position: 4.1370000
Arabidopsis identities: 0.846
Best GenBank protein hit: CAA65735.1
Evalue: 6e-104
Identities: 0.973
Description: aconitate hydratase [Solanum tuberosum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39582)
Chromosome
7
Position
43.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1329 was used as an overgo probe on plate 8 [well F1]

Plausible BAC Matches:   P006P10,   P073N22,   P223A12

 Overgo Sequences

A sequence
TGAACCTAGACCTTGCCGATGTTG
B sequence
CCTGACAGACATGGTTCAACATCG
AB sequence
TGAACCTAGACCTTGCCGATGTTGAACCAT
Marker sequence
GGAGAAGTGATGAAACAGTTGGAATGGTAGAGTCATATCTCCGTGCAAAT
AATATGTTTGTTGATTATAAAGAGCCTCAACAAGAAAAGGTGTACTCTTC
TTATTTGAACCTAGACCTTGCCGATGTTGAACCATGTCTGTCAGGGCCAA
AGAGACCTCATGACCGTGTGCCTTTGAAAGAAATGAAGTCTGACTGGCAT
GCTTGCCTAGATAACAAAGTTGGATTCAAGGGATTTGCTGTGCCAAAAGA
GGTGCAAGATAAAGTGGCCAAGTTTTCCTTCCATGGGCAACCTGCAGAGC
TCAAACATGGCAGTGTTGTGATTGCTGCTATCACAAGTTGCACAAATACA
TCCAATCCCAGTGTTATGCTAGGAGCAGCTCTGGTTGCCAAAAAGGCATC
TGAGCTGGGTCTACATGTTAAGCCATGGGTTAAAACTAGCCTTGCCCCAG
GCTCTGGTGTTGTTACAAAATATTTACTCAAGAGTGGTCTACAGAAGTAT
TTAAATCAGCAAGGTTTCAACATTGTTGGCTATGGCTGCACCACTTGTAT
AGGGAACTCTGGGGGACTTGGATGAATCTG
Genomic location of T1329  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1931 marker 1931
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)