SGN Marker T1331

SGN-M1933
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAN47TH
Arabidopsis best BAC match: AB022219.1
Arabidopsis position: 3.0450000
Arabidopsis identities: 0.500
Best GenBank protein hit: BAB02058.1
Evalue: 2.1e-26
Identities: 0.460
Description: similar to unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49423)
Chromosome
3
Position
54.18 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47357)
Chromosome
3
Position
64.83 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39583)
Chromosome
3
Position
78.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1331 was used as an overgo probe on plate 6 [well E8]

Plausible BAC Matches:   P031P17

 Overgo Sequences

A sequence
CTCAGCAACCCTTTTCTCTGTTCC
B sequence
GGAAGTGGAAAGAGGAGGAACAGA
AB sequence
CTCAGCAACCCTTTTCTCTGTTCCTCCTCT
Marker sequence
GCTTAAACCGCTGCACACTCTGTCATTTCTCCGGCGGGCAATTTCTCTCA
ATGAAGAAAGCAAAAGAGTAAAGAAGAAATCGGAGAAACAAGAAGTACTC
AAGTAAAACGATGAGTGCAATCCATTTGAGCACTCTCAGAAGCATTTCTC
AGCAACCCTTTTCTCTGTTCCTCCTCTTTCCACTTCCCAAATTCAAATCC
ATTAACAATACACGAATCAAAGCATCATCAGTAAAAGAAGAAGAAGTAGA
GAGGAAGATAGAAATTCGAGTTTGTACAGAGAGGGCATGCAGGAAACAGG
GATCCTTGGATACCCTTCAAGTTTTATCTGGAATTGCTCCTCCCTTTGTA
GCTGTTAATTCCTGTGGATGTCTTGGCCGTTGCGGGGCTGGACCTAATGT
CGTCGTTTTACCTGGTGCTGTATATGTCAAGCACGTTGGTACTGCTACTC
GAGCTGCTGAAACTATGGCGTTCGTCTGCCTTGGTAGGGATGATGTTGAC
GGAGAGAGTANGAGAAGTTTGGAGGCTTTAGCGTTGAGGAAAAGAGCTGA
AGATGAGATGGGTAATGGTAATTTCTCTGAGGCTCATGGTTTGCTCTCAC
AGGCTATTGCTCTAAAGCCCGTTGGAGGTGTTCATATTATGCTCAAA
Genomic location of T1331  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1933 marker 1933
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)