SGN Marker solcap_snp_sl_15050

SGN-M19334

Synonyms  
Le016522_113
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71034)
Chromosome
1
Position
0.54 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67393)
Chromosome
1
Position
2.86 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63834)
Chromosome
1
Position
0.67 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55665)
Chromosome
1
Position
0.30 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTCTCCCCGGTAGCTGGAAAATGGGGTATCACCCGCCTCTTGACAAGCAC
  
3' flanking region
GGATGTAACAAATCAAACTCTAAGCTTGGTTCCTTTAACGCCGAGCTCAC
SNP nucleotide
TC
SNPdb format
CTCTCCCCGGTAGCTGGAAAATGGGGTATCACCCGCCTCTTGACAAGCAC[T/C]
GGATGTAACAAATCAAACTCTAAGCTTGGTTCCTTTAACGCCGAGCTCAC
  
Genomic location of solcap_snp_sl_15050  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19334 marker 19334
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)