SGN Marker solcap_snp_sl_1516

SGN-M19347

Synonyms  
SGN-U581468_snp1097
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71042)
Chromosome
12
Position
26.26 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67398)
Chromosome
12
Position
38.92 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63839)
Chromosome
12
Position
40.22 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55678)
Chromosome
12
Position
3.38 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAAGCTTATGTTTTTACAAGTGTTTTTTACTATGAAACTATGTAAAGTTG
  
3' flanking region
TAGTATTGAAAGTGTGTGGTTTGTATTTGAATCTCCTGTGAAATGTTGTG
SNP nucleotide
AC
SNPdb format
AAAGCTTATGTTTTTACAAGTGTTTTTTACTATGAAACTATGTAAAGTTG[A/C]
TAGTATTGAAAGTGTGTGGTTTGTATTTGAATCTCCTGTGAAATGTTGTG
  
Genomic location of solcap_snp_sl_1516  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19347 marker 19347
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)