SGN Marker T1335

SGN-M1935
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.05.01
Tomato EST read: TPTAN80TH
Arabidopsis best BAC match: AC008075.2
Arabidopsis position: 1.1340000
Arabidopsis identities: 0.830
Best GenBank protein hit: CAB96077.1
Evalue: 6e-144
Identities: 0.991
Description: alpha-glucosidase [Solanum tuberosum subsp. tuberosum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49424)
Chromosome
5
Position
3.64 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47358)
Chromosome
5
Position
46.08 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39584)
Chromosome
5
Position
39.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1335 was used as an overgo probe on plate 11 [well D11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TTGGAGGAGCTATGCAATCGTTGG
B sequence
ACGCGCCTACTTGAATCCAACGAT
AB sequence
TTGGAGGAGCTATGCAATCGTTGGATTCAA
Marker sequence
GCAAATACCAAGGTAAACCATTTCTAGCACAAGTCTGGCCTGGTGCTGTT
CATTTCCCTGACTTCCTCAACCCTAAAACAGTTGAGTGGTGGGGTGATGA
GATTCGACGATTCCATGAACTTGCTCCTATTGATGGACTATGGATTGACA
TGAATGAAGTTTCCAACTTTTGTAATGGTTTGTGCACGATCCCCGAGGGT
AGGATATGCCCTAATGGGACAGGTCCTGGTTGGATATGTTGTTTGGATTG
CAAGAATGTAACGAAAACAAAGTGGGATGATCCGCCTTACAAGATAAATG
CTTCTGGTATTCAAGCTCCAATAGGGTACAAAACGATTGCTACGAGTGCA
ACACATTACAATGGTGTTAGGGAATATGATGCTCATAGTCTTTATGGTTT
CTCTGAGACTATTGCAACTCACAAGGGTCTACAAGCGATAGAGGGGAAAC
GTCCCTTCATATTGACTCGTGCCACGTTTGTTGGTTCAGGACATTATGCT
GCACATTGGACAGGGGATAACAAAGGAACTTGGGAGGATTTGAAGTATTC
AATCTCAACTGTCTTGAACTTTGGTATGTTTGGTGTTCCTATGGTTGGTT
CAGACATATGTGGTTTTTACCCCGCGGCTCCTCCTTTGGAGGAGCTATGC
AATCGTTGGATTCAAGTAGGCGCGTTCTATCCCTTCTCAAGGGATCAC
Genomic location of T1335  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1935 marker 1935
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)