SGN Marker solcap_snp_sl_15247

SGN-M19355

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63841)
Chromosome
11
Position
37.19 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55686)
Chromosome
11
Position
4.80 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGTTTGCTAACTGGAAGGCAATAGAATCAGCCGATAGGCACAGGCAAGGC
  
3' flanking region
AATCACTTAGATTAGCCACCATCTTATTCTAGGATTCACCAATTAAGGGG
SNP nucleotide
AG
SNPdb format
AGTTTGCTAACTGGAAGGCAATAGAATCAGCCGATAGGCACAGGCAAGGC[A/G]
AATCACTTAGATTAGCCACCATCTTATTCTAGGATTCACCAATTAAGGGG
  
Genomic location of solcap_snp_sl_15247  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19355 marker 19355
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)