SGN Marker solcap_snp_sl_15260

SGN-M19359

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67401)
Chromosome
11
Position
36.10 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55690)
Chromosome
11
Position
4.94 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCTGGTGGCTTCCCATTACTTCCCCCTCCCACGTTATCAGGAAAACTCTT
  
3' flanking region
GGTGCAAAAGATTTCTCCACAACCACTTCTTCTTCATTCTCTTGTAACAA
SNP nucleotide
AG
SNPdb format
TCTGGTGGCTTCCCATTACTTCCCCCTCCCACGTTATCAGGAAAACTCTT[A/G]
GGTGCAAAAGATTTCTCCACAACCACTTCTTCTTCATTCTCTTGTAACAA
  
Genomic location of solcap_snp_sl_15260  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19359 marker 19359
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)