SGN Marker solcap_snp_sl_15284

SGN-M19363

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71047)
Chromosome
11
Position
45.95 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67404)
Chromosome
11
Position
48.42 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63846)
Chromosome
11
Position
47.30 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55694)
Chromosome
11
Position
7.24 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AATGATGAATTTGATGCCCAGTTCTGGTTTCCCCCACAACCAGAAGACGA
  
3' flanking region
GATGATGATATTGAGGACAGTGTGGCTAATTATGATGACGACGAATGTGT
SNP nucleotide
TC
SNPdb format
AATGATGAATTTGATGCCCAGTTCTGGTTTCCCCCACAACCAGAAGACGA[T/C]
GATGATGATATTGAGGACAGTGTGGCTAATTATGATGACGACGAATGTGT
  
Genomic location of solcap_snp_sl_15284  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19363 marker 19363
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)