SGN Marker T1347

SGN-M1940
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TPTAO25TH
Arabidopsis best BAC match: AB019233.1
Arabidopsis position: 5.2400000
Arabidopsis identities: 0.625
Best GenBank protein hit: AAA80575.1
Evalue: 1.4e-91
Identities: 0.775
Description: possible apospory-associated protein [Pennisetum ciliare]
Comment: apospory: obligate apomixis
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39586)
Chromosome
7
Position
37.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1347 was used as an overgo probe on plate 9 [well G6]

Plausible BAC Matches:   P009C02,   P028J02,   P281D13,   P212P11,   P238P09,   P257C08,   P112P11,   P094D21,   P019A04,   P308H03,   P175D15,   P201A17

 Overgo Sequences

A sequence
ACGAAGGGCGTTAATGGCCTTGAA
B sequence
CCCGGAGAATCACTTTTTCAAGGC
AB sequence
ACGAAGGGCGTTAATGGCCTTGAAAAAGTG
Marker sequence
GATGACGTCTTCTACTAGTGAGAAACCATTAGTGGAGTTGACGAAGGGCG
TTAATGGCCTTGAAAAAGTGATTCTCCGGGAGATTCGTGGCAGTTCTGCC
GAGGTGTATCTCTATGGTGGTCAGGTGACGTCTTGGAAGAATGATCAGAG
AGAGGAATTGCTCTTTGTTAGTAGCAAGGCCATTTTTAAGCCTCCAAAAG
CAATTCGTGGGGGTATTCCTATATGTTTCCCGCAGTTCGCAAATCGTGGC
CCTCTTGAGTCGCATGGATTTGCCCGAAACAGGTTTTGGAGCATTGACAA
AGACCCCCCTCCATTTCCAGCAGCTACTTCTTCTAGGGCTTTTGTTGACT
TGATACTGAAACCGTCTGAGGAGGACTTGAAAATTTGGCCTCACAGTTTT
GAGTTTCGGCTGCGGGTAGCTTTGAGTCCTGCTGGAGATTTGATGTTGAC
ATCTCGTATTAGAAACACCAGCACTGATGGAAAGCCTTTCGCATTTACAT
TTGCATATCACACCTACTTCTCTGTTTCAGACATCAGTGAAGTCCGCGTG
GAGGGCCTTGAGACACTTGATTATCTTGAGAATAAGGAGAGATTCACTGA
GCAAGGCGATGCAATTACTTTTGAGTCTGAAGTGGACAAAATAT
Genomic location of T1347  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1940 marker 1940
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)