SGN Marker solcap_snp_sl_15930

SGN-M19469

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71091)
Chromosome
4
Position
62.49 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55800)
Chromosome
4
Position
57.94 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGTTTGGTTCATTGACTTTGGCTCTAATGAAGGTTGGCAAGTTTTTTAGA
  
3' flanking region
GGATGCCTTCCATGCTAGGTATCCAATCTATAATCGTGTCTAAATGACAT
SNP nucleotide
AC
SNPdb format
TGTTTGGTTCATTGACTTTGGCTCTAATGAAGGTTGGCAAGTTTTTTAGA[A/C]
GGATGCCTTCCATGCTAGGTATCCAATCTATAATCGTGTCTAAATGACAT
  
Genomic location of solcap_snp_sl_15930  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19469 marker 19469
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)