SGN Marker solcap_snp_sl_15960

SGN-M19470

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71092)
Chromosome
3
Position
67.95 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67446)
Chromosome
3
Position
54.14 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63876)
Chromosome
3
Position
64.59 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55801)
Chromosome
3
Position
56.63 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCCCACATCATGAAAACTCAGGATCTGGGTTTTGCTAACAAGCCCAAGTC
  
3' flanking region
ATTATTCCCAGCAAGCTTTTTTTCGGCCCAAAAGACGTAGCCTTCACTCC
SNP nucleotide
AC
SNPdb format
TCCCACATCATGAAAACTCAGGATCTGGGTTTTGCTAACAAGCCCAAGTC[A/C]
ATTATTCCCAGCAAGCTTTTTTTCGGCCCAAAAGACGTAGCCTTCACTCC
  
Genomic location of solcap_snp_sl_15960  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19470 marker 19470
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)