Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_16410

SGN-M19512

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71111)
Chromosome
12
Position
43.83 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67461)
Chromosome
12
Position
54.24 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55843)
Chromosome
12
Position
45.65 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACTCCCAGATAATTTGAGTTTGAAATTGCACTGTTTTAACGAGTTTCTTG
  
3' flanking region
AAGTTGCAACTTGCAACATACACTCCCAGATAACTACAACTTTTAGTAAT
SNP nucleotide
CG
SNPdb format
ACTCCCAGATAATTTGAGTTTGAAATTGCACTGTTTTAACGAGTTTCTTG[C/G]
AAGTTGCAACTTGCAACATACACTCCCAGATAACTACAACTTTTAGTAAT
  
Genomic location of solcap_snp_sl_16410  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19512 marker 19512
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)