SGN Marker solcap_snp_sl_16425

SGN-M19515

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71113)
Chromosome
11
Position
50.06 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55846)
Chromosome
11
Position
10.02 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTTACAGAGCAATTGATTTCGCAATTACTCAGAGATTTTAGAGCATAACT
  
3' flanking region
TACTTCTGTAGACAAGATTGGTTTGAAAAAGCTATTCTTCAACTTCGTTA
SNP nucleotide
AG
SNPdb format
GTTACAGAGCAATTGATTTCGCAATTACTCAGAGATTTTAGAGCATAACT[A/G]
TACTTCTGTAGACAAGATTGGTTTGAAAAAGCTATTCTTCAACTTCGTTA
  
Genomic location of solcap_snp_sl_16425  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19515 marker 19515
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)