SGN Marker T1360

SGN-M1952
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.13
Tomato EST read: TPTAP20TH
Arabidopsis best BAC match: AC002387.2
Arabidopsis position: 2.2430000
Arabidopsis identities: 0.939
Best GenBank protein hit: AAB82636.1
Evalue: 4.0e-49
Identities: 0.809
Description: putative O-sialoglycoprotein endopeptidase [Arabidopsis
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39592)
Chromosome
5
Position
73.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1360 was used as an overgo probe on plate 11 [well H6]

Plausible BAC Matches:   P169M21,   P022B23,   P267B18,   P279G03,   P266B18,   P201O22,   P155D04

 Overgo Sequences

A sequence
ATTTCCCGTCTAAGCCTGCTATGG
B sequence
GGTGAATTGAGGGTCTCCATAGCA
AB sequence
ATTTCCCGTCTAAGCCTGCTATGGAGACCC
Marker sequence
GCCAATTTCCCGTCTAAGCCTGCTATGGAGACCCTCAATTCACCTCACAA
GCAAATTGCAATTGCAATTGCAATTGCATCAAAAAACAGTAAAACCCAAA
TGGTTCAAATCTTTTTCACCTCATTGTTCTACTTCTGTTTCTAATGAGAA
TTTAGTTGTTTTAGGCATTGAAACGAGCTGTGATGATACCGCTGCTGCTG
TGGTTAATAGCAATGGTGAAATTCTCAGCCAAGTTATCTCTTCTCAGAAC
TGCTTGCGCGATATGGAGGAGTTGCTCCTAAGATGGCAGAGGAAGCACAT
GCTCTGGTGATTGATCAGGTGGTACAAGAAGCACTAGATAAAGCTAATCT
GACTGAGAAAGATCTAACTGCAGTTGCTGTCACGATTGGTCCTGGTTTAA
GCCTTTGTTTGCGAATTGGTGTGCGGAAAGCAAGAAGTGTTGCCGGTTCT
CATAATTTACCTCTTGTTGGTGTCCATCATATGGAAGCTCACACTCTGGT
TGCCAGGCTAGTAGACAGAGAGCTGCAGTTTCCTTTTATGGCCCTACTTG
TTTCAGGTTAGATAACCTTCTAGAATTTTATAGGTCTGTTTTATTTACTC
TTACTGAAAATACATTGGGTCATC
Genomic location of T1360  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1952 marker 1952
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)