SGN Marker solcap_snp_sl_16511

SGN-M19523

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71116)
Chromosome
10
Position
29.49 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67464)
Chromosome
10
Position
41.71 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55854)
Chromosome
10
Position
57.51 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGCTGGTTGCAGTTGTGGAGGTTAACATCACATTGTGCATGTATCATTGA
  
3' flanking region
GAAATTCCAAAATCAGGTAACAAGGGACTAAAATGTGAACCTGATATACT
SNP nucleotide
TC
SNPdb format
AGCTGGTTGCAGTTGTGGAGGTTAACATCACATTGTGCATGTATCATTGA[T/C]
GAAATTCCAAAATCAGGTAACAAGGGACTAAAATGTGAACCTGATATACT
  
Genomic location of solcap_snp_sl_16511  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19523 marker 19523
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)