SGN Marker solcap_snp_sl_16794

SGN-M19546

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71123)
Chromosome
12
Position
39.45 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67470)
Chromosome
12
Position
51.09 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55877)
Chromosome
12
Position
9.97 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GAACTAGGAGCAGGACATCCAAGAAGAGCAAAGCTTTCAGTATTAGTGGT
  
3' flanking region
TCAATAACTTCACTTGTAATTGGTGCATTATTGACAATATTACTCTTACT
SNP nucleotide
AG
SNPdb format
GAACTAGGAGCAGGACATCCAAGAAGAGCAAAGCTTTCAGTATTAGTGGT[A/G]
TCAATAACTTCACTTGTAATTGGTGCATTATTGACAATATTACTCTTACT
  
Genomic location of solcap_snp_sl_16794  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19546 marker 19546
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)