SGN Marker solcap_snp_sl_1698

SGN-M19556

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71129)
Chromosome
4
Position
38.52 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67475)
Chromosome
4
Position
49.98 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63901)
Chromosome
4
Position
52.68 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55887)
Chromosome
4
Position
7.22 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTTCAGCAACTTTACCATCTTCATTCACTTTATTCTTCCCTTTGAAGCCA
  
3' flanking region
AACCAAAAACAAATGTGTCATTCAGTTTTGGACCCTGATACTCTGGTTCC
SNP nucleotide
CG
SNPdb format
CTTCAGCAACTTTACCATCTTCATTCACTTTATTCTTCCCTTTGAAGCCA[C/G]
AACCAAAAACAAATGTGTCATTCAGTTTTGGACCCTGATACTCTGGTTCC
  
Genomic location of solcap_snp_sl_1698  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19556 marker 19556
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)