SGN Marker solcap_snp_sl_16993

SGN-M19561

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67478)
Chromosome
4
Position
48.72 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63903)
Chromosome
4
Position
56.78 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55892)
Chromosome
4
Position
5.98 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCGTATTCAGTTGTGTCAATTAGTCAGTTGTACGAGGGCTCGTGGTAGGC
  
3' flanking region
TGTGAGTTTAATTGCTCAACTGATTTGATGATGTACTGCTTAGAGATTTG
SNP nucleotide
AG
SNPdb format
TCGTATTCAGTTGTGTCAATTAGTCAGTTGTACGAGGGCTCGTGGTAGGC[A/G]
TGTGAGTTTAATTGCTCAACTGATTTGATGATGTACTGCTTAGAGATTTG
  
Genomic location of solcap_snp_sl_16993  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19561 marker 19561
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)