SGN Marker solcap_snp_sl_17071

SGN-M19568

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63905)
Chromosome
1
Position
66.68 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55899)
Chromosome
1
Position
74.36 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGCTGGGAGTTGCTAAGAAACGTGATCATGCATCTGGTATTTTGGAACAA
  
3' flanking region
TTATCTATTTTTTGCCAAACTGCAGATTGAACTTCTAAAAGCTTTCTTGC
SNP nucleotide
TG
SNPdb format
AGCTGGGAGTTGCTAAGAAACGTGATCATGCATCTGGTATTTTGGAACAA[T/G]
TTATCTATTTTTTGCCAAACTGCAGATTGAACTTCTAAAAGCTTTCTTGC
  
Genomic location of solcap_snp_sl_17071  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19568 marker 19568
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)