SGN Marker T1368

SGN-M1957
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.01.10
Tomato EST read: TPTAQ13TH
Arabidopsis best BAC match: AL023094.2
Arabidopsis position: 4.1760000
Arabidopsis identities: 0.792
Best GenBank protein hit: AAA61347.1
Evalue: 1.5e-81
Identities: 0.960
Description: arginine decarboxylase [Lycopersicon esculentum]
Comment: decarboxylation of L-arginine
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39595)
Chromosome
1
Position
162.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1368 was used as an overgo probe on plate 7 [well G12]

Plausible BAC Matches:   P128J14

 Overgo Sequences

A sequence
AAGCGGTCCTCTATGTCTGTGATC
B sequence
TGCTTTACGCCCTTACGATCACAG
AB sequence
AAGCGGTCCTCTATGTCTGTGATCGTAAGG
Marker sequence
GGCATTTTCACATTGGATCTCAGATCCCCACAACAGAGTTGCTTGCTGAT
GGTGTTGGTGAGGCCACTCAGATTTACTCTGAATTAGTCCGTCTTGGAGC
TGGTATGAAATTCATTGATATCGGAGGGGGGCTTGGAATCGACTATGACG
GTTCTAAATCAAGCAATTCTGATGTCTCTGTTGGCTATGGCATTGAAGAA
TATGCCTCTGCTGTTGTCCAAGCGGTCCTCTATGTCTGTGATCGTAAGGG
CGTAAAGCATCCAGTGATTTGCAGCGAAAGTGGCAGGGCAATTGTTTCTC
ACCATTCAATTCTGATTTTTGAAGCCGTGTCTGCTTCTACTACTCATGTT
TCTACGCAGCCATCTTCGGGTGGTTTACAATCCTTGGTGGAGACTCTCAA
TGAAGATGCCCGTGCTGACTACCGAAACTTATCTGCTGCTGCTGTNCCGG
GAGAATATGATACATGTCTCATCTATTCTGATCAATTGAAACAGAGATGT
GTTGAACACGTCAAAGATGGGTCCTTGGATATTGA
Genomic location of T1368  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1957 marker 1957
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)