SGN Marker solcap_snp_sl_17161

SGN-M19576

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71137)
Chromosome
2
Position
54.69 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67487)
Chromosome
2
Position
74.28 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55907)
Chromosome
2
Position
42.19 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCACTTGATTTGATAGCAGAAGCAAAAGTAGATCCAGAATCCAGGTTAAT
  
3' flanking region
GAACATTTATTGCTTGTAAAAGATTTCTGGTTCTGACCAGAAGATGGATC
SNP nucleotide
AT
SNPdb format
TCACTTGATTTGATAGCAGAAGCAAAAGTAGATCCAGAATCCAGGTTAAT[A/T]
GAACATTTATTGCTTGTAAAAGATTTCTGGTTCTGACCAGAAGATGGATC
  
Genomic location of solcap_snp_sl_17161  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19576 marker 19576
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)