Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_17641

SGN-M19630

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71142)
Chromosome
4
Position
39.62 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67506)
Chromosome
4
Position
51.25 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55961)
Chromosome
4
Position
46.73 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGACCATGAGAGGGAGAAATAATATTGTGATATATGAAGAAGAGCTTGGC
  
3' flanking region
AATAGTGGTGGAAGTCACAGATGAACCAATCTTAGGCTTCAAAAGATTGT
SNP nucleotide
TG
SNPdb format
TGACCATGAGAGGGAGAAATAATATTGTGATATATGAAGAAGAGCTTGGC[T/G]
AATAGTGGTGGAAGTCACAGATGAACCAATCTTAGGCTTCAAAAGATTGT
  
Genomic location of solcap_snp_sl_17641  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19630 marker 19630
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)