SGN Marker solcap_snp_sl_17648

SGN-M19633

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55964)
Chromosome
4
Position
40.78 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CGGGAACAAGAAAAAAGTTTTTACATGAGCCAGTTCCGAAGTTAGAATTT
  
3' flanking region
TACGCACACTACTAATTGACAACTATGACAGTTACACTTACAATATTTTC
SNP nucleotide
AG
SNPdb format
CGGGAACAAGAAAAAAGTTTTTACATGAGCCAGTTCCGAAGTTAGAATTT[A/G]
TACGCACACTACTAATTGACAACTATGACAGTTACACTTACAATATTTTC
  
Genomic location of solcap_snp_sl_17648  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19633 marker 19633
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)