Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_17771

SGN-M19658

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71152)
Chromosome
4
Position
39.35 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67516)
Chromosome
4
Position
50.30 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55989)
Chromosome
4
Position
9.61 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTATAAAATGTGATCTTGTATACTTCCTGGACAACCATCAACCATCCAT
  
3' flanking region
TGTTCTGCCTTTGTGTAGCCCTCACCTGGTTTTTTATTAACCGCTCCCAG
SNP nucleotide
TC
SNPdb format
TTTATAAAATGTGATCTTGTATACTTCCTGGACAACCATCAACCATCCAT[T/C]
TGTTCTGCCTTTGTGTAGCCCTCACCTGGTTTTTTATTAACCGCTCCCAG
  
Genomic location of solcap_snp_sl_17771  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19658 marker 19658
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)