SGN Marker solcap_snp_sl_17837

SGN-M19665

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67517)
Chromosome
10
Position
14.29 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63924)
Chromosome
10
Position
22.71 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55996)
Chromosome
10
Position
1.69 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CGGTCTGACTCTTGTCTTATGTCAAGTCTCACAAATGAGAGTCCAAAGGT
  
3' flanking region
GAAACTTGTCTTAGAAAATCCAGAAGGCTTCCATCGGCAATGGGACGATC
SNP nucleotide
AT
SNPdb format
CGGTCTGACTCTTGTCTTATGTCAAGTCTCACAAATGAGAGTCCAAAGGT[A/T]
GAAACTTGTCTTAGAAAATCCAGAAGGCTTCCATCGGCAATGGGACGATC
  
Genomic location of solcap_snp_sl_17837  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19665 marker 19665
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)