SGN Marker solcap_snp_sl_17922

SGN-M19675

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71156)
Chromosome
4
Position
66.07 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56006)
Chromosome
4
Position
58.69 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CATCGAGATATTTGGTTTACAAGATAAAAACGAGAAATCAGGTGATTCTA
  
3' flanking region
TTGGTTTTCAAAAAACTATCCAACTAGGAACACGAAATTCGAGATATTTA
SNP nucleotide
CG
SNPdb format
CATCGAGATATTTGGTTTACAAGATAAAAACGAGAAATCAGGTGATTCTA[C/G]
TTGGTTTTCAAAAAACTATCCAACTAGGAACACGAAATTCGAGATATTTA
  
Genomic location of solcap_snp_sl_17922  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19675 marker 19675
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)