Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_18056

SGN-M19681

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71160)
Chromosome
4
Position
92.18 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67524)
Chromosome
4
Position
107.80 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63931)
Chromosome
4
Position
156.16 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56012)
Chromosome
4
Position
63.71 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACCACTGATGGTAATGAATTCTTGCAACATAGTCCAGGCATCTTCAATGC
  
3' flanking region
CCATTCGACTCTTCTTTTATGTGGCCTACAACTATAGATGCCAACAATGT
SNP nucleotide
AG
SNPdb format
ACCACTGATGGTAATGAATTCTTGCAACATAGTCCAGGCATCTTCAATGC[A/G]
CCATTCGACTCTTCTTTTATGTGGCCTACAACTATAGATGCCAACAATGT
  
Genomic location of solcap_snp_sl_18056  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19681 marker 19681
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)