SGN Marker solcap_snp_sl_1813

SGN-M19686

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71162)
Chromosome
1
Position
65.93 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56017)
Chromosome
1
Position
74.28 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTATCAGTTCCCATCTTAGCAACCACAGTCCCAAATCTCACACCGGACAC
  
3' flanking region
TTTTCACCGCCGGAAACTCCAATCTGGTGGTTCTTCCCTCCGTCGCCGCC
SNP nucleotide
AT
SNPdb format
CTATCAGTTCCCATCTTAGCAACCACAGTCCCAAATCTCACACCGGACAC[A/T]
TTTTCACCGCCGGAAACTCCAATCTGGTGGTTCTTCCCTCCGTCGCCGCC
  
Genomic location of solcap_snp_sl_1813  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19686 marker 19686
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)