SGN Marker T1385

SGN-M1969
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAR17TH
Arabidopsis best BAC match: AL022604.1
Arabidopsis position: 4.1800000
Arabidopsis identities: 0.876
Best GenBank protein hit: CAB80242.1
Evalue: 2e-122
Identities: 0.932
Description: putative protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39596)
Chromosome
1
Position
165.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1385 was used as an overgo probe on plate 3 [well C3]

Plausible BAC Matches:   P041O24,   P157J23,   P260A18,   P127G20,   P091I01,   P074L15,   P248N01,   P307O04,   P034P08,   P060N11,   P042F02,   P284F16,   P162J06,   P020G17,   P123A10,   P219I17,   P122P10,   P109C06,   P244N20,   P204J20,   P288F11,   P288C11,   P288D11,   P022P21,   P247P20,   P288C12,   P221I19,   P231M15,   P176J23,   P032N15,   P216E07

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
AGAGAAGTTTCTCCGCGATTCAGG
B sequence
TACAACGTGGTTCAGGCCTGAATC
AB sequence
AGAGAAGTTTCTCCGCGATTCAGGCCTGAA
Marker sequence
GCAGATGTCTTGTAAGGCCTAGGCCTGCTCCTGCCGATTTTCTTCGTGAT
TGGGGCGCTACGGTTGTCAATGCAGATTTAAGCAAACCTGAAACAATTCC
AGCAACATTGGTTGGAGTCCATACAGTTATTGATTGTGCTACTGGACGCC
CTGAGGAGCCTATAAAAACTGTAGATTGGGAAGGAAAAGTGGCTCTTATA
CAATGTGCAAAAGCCATGGGCATTCAAAAATTTATATTTTTCTCCATTCA
CAACTGCGACAAGCATCCTGAAGTTCCTCTGATGGAGATCAAACACTGTA
CAGAGAAGTTTCTCCGCGATTCAGGCCTGAACCACGTTGTAATTCGGTTA
TGTGGCTTCATGCAGGGCCTTATTGGTCAATATGCAGTGCCTATATTAGA
AGAGAAATCTGTATGGGGAACCGATGCTCCCACTCGAATAGCATACATGG
ACACCCAAGATATTGCTCGGTTGACATTCATAGCTTTACGCAATGAGAAT
ATTAATGGGAAGCTTCTCACTTTTGCTGGGCCTCGGGCATGGACAACCCA
AGAGGTGATAACATTGTGCGAGAGACTTGCTGGTCAAGATGCCAATGTGA
CTACAGTGCCTGTGTCAGTTTTGCGATTTACACGTCAGCTGACTCGGTTG
TTTGAGTGGACGAATGATG
Genomic location of T1385  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1969 marker 1969
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)