Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker TG555

SGN-M197

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1600
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG555 image not available
Forward sequence
AATTCGGAGCTCACTGCTTCTAATCCTCAGTGAGACTTATTTTCTACATATTAAACAATAAGAAATTTACGAAGGAATATTATAGACTGA
ATTCCTTGGTGACAAGTATCAAGACATCTTGACCAAGTTTAAAGTTTTGTAGTGGCAGTTCTTTTAAGCTTTACTTGTGTGAGGTAGACA
TCAAGGAAGATAAGTAGCAGCTACTCTTCACGGAGCAGCCCATAGGACACTCAAATTCACTATTGCGAGGGTCAATCTACCAATTTATGG
AACGATACCAGTAAAGTCATTTTTATGTAAACATCAGACAGCTTTTGACTAAGCAGAGACATGAATAAGTTCTATTTGTTAGAAGTCGAA
GAGACAAATAAGTTAATTTCACCTATGCTATAAAAGAGGACTCTTATAGTTATAAATACAGTACATTTTATTAAGGGTTCTAATTGTTGA
CTATGATAGCAAGCATGCCGTACTAATT
Reverse sequence
ACATTTTGAGGAAGACAGGAGTTATGTATCGCCATCTGGTGTGCTCCAAGAACATGACAGATATAAAAGACCGCGGGGTGCACCAGAGAA
ATGTTGCATTGGAGCATATTGAACATCATAGGCTCAATGGAATTGTTTACTTTGCAGATGATGATAATATCTACTCACTTGAGTTGTTTG
AGAGCATTAGATCGATCAAGTAAGTTGAGATTCATCAGTCTTGTTTACATGACTTGTCTTTGTTTTGTCCTGCTGTGAGCATGTTCAGGA
TGATGTTATGTGCTTTATGTAGATGTTCAAGTCGATAATAGTGAATAGTCTAGAGCTATTTCACATATATTACAACTTCACTAACAAATT
CTTTTCCTGGTGTCCTCGGTTCATCACTCTTCATAGTTATAAGAATAACAGTTGTAGATTAGACCACTGGTCGTGTGATTTTTGGACTTA
ATTATTATCTCAATTCTTCCTCAAAATAGCAGTCCTTAGATTAGAAGCTGAGG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1549851e-109199 (39.6% of RFLP seq)-
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53903)
Chromosome
4
Position
0.00 cM
Confidence
uncalculated
Protocol
RFLP

2_Isobutylthiazole_content_ibt4_1 2_Methylthio_ethanol_content_meo4_1 Dry_matter_weight_dmw4_1 6_Methylhept_5_en_2_one_content_mhn4_1 Lycopene_content_lyc4_1 2_Methylbut_2_enal_content_bea4_1Color_L_L4_1 Color_a_a4_1Hexanal_content_hxa4_1 3_Methylpentan_1_ol_content_mno4_1 Elasticity_ela4_1 Color_b_b4_1Firmness_fir4_1
Tomato QTL map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53353)
Chromosome
4
Position
56.47 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_4 MQTL_1_Late_blight_5.2 MQTL_2_Late_blight_4
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50408)
Chromosome
4
Position
59.46 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48340)
Chromosome
4
Position
78.07 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42487)
Chromosome
4
Position
88.20 cM
Confidence
I
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40085)
Chromosome
4
Position
91.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8546)
Chromosome
4
Position
68.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8545)
Chromosome
4
Position
87.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG555 was used as an overgo probe on plate 8 [well A3]

Plausible BAC Matches:   P110L05

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GTGTGAGGTAGACATCAAGGAAGA
B sequence
GAGTAGCTGCTACTTATCTTCCTT
AB sequence
GTGTGAGGTAGACATCAAGGAAGATAAGTA
Marker sequence
AATTCGGAGCTCACTGCTTCTAATCCTCAGTGAGACTTATTTTCTACATA
TTAAACAATAAGAAATTTACGAAGGAATATTATAGACTGAATTCCTTGGT
GACAAGTATCAAGACATCTTGACCAAGTTTAAAGTTTTGTAGTGGCAGTT
CTTTTAAGCTTTACTTGTGTGAGGTAGACATCAAGGAAGATAAGTAGCAG
CTACTCTTCACGGAGCAGCCCATAGGACACTCAAATTCACTATTGCGAGG
GTCAATCTACCAATTTATGGAACGATACCAGTAAAGTCATTTTTATGTAA
ACATCAGACAGCTTTTGACTAAGCAGAGACATGAATAAGTTCTATTTGTT
AGAAGTCGAAGAGACAAATAAGTTAATTTCACCTATGCTATAAAAGAGGA
CTCTTATAGTTATAAATACAGTACATTTTATTAAGGGTTCTAATTGTTGA
CTATGATAGCAAGCATGCCGTACTAATT
Genomic location of TG555  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D197 marker 197
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)