SGN Marker T1388

SGN-M1970
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 10.01.01.01
Tomato EST read: TPTAR26TH
Arabidopsis best BAC match: AL035394.1
Arabidopsis position: 4.1210000
Arabidopsis identities: 0.609
Best GenBank protein hit: CAB81292.1
Evalue: 1.7e-45
Identities: 0.609
Description: putative receptor kinase [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39597)
Chromosome
3
Position
47.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 13977
Forward primer (5'-3')
GCGATTTGGCTATCTGGGTA
Digested band sizes (using HinfI)
Solanum pennellii LA716: 270+480
Solanum lycopersicum LA925: 200+350
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AACCGAAAGGCTTTTCCAAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1000
Solanum lycopersicum LA925: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 13977
Forward primer (5'-3')
GCGATTTGGCTATCTGGGTA
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 200+350
Solanum pennellii LA716: 270+480
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AACCGAAAGGCTTTTCCAAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1000
Solanum lycopersicum LA925: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 14092
Forward primer (5'-3')
GCGATTTGGCTATCTGGGTA
Digested band sizes (using HincII)
Solanum lycopersicum LA925: 200+700
Solanum pimpinellifolium LA1589: 300+700
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AACCGAAAGGCTTTTCCAAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1000
Solanum lycopersicum LA925: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 42
Forward primer (5'-3')
Unknown
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 200+350
Solanum pennellii LA716: 270+480
Mg+2 concentration
3mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Solanum pennellii LA716: 1000
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
T1388 was used as an overgo probe on plate 2 [well F10]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P317E07,   P065D01,   P243M03

 Overgo Sequences

A sequence
TAGCAATCAGGTTGCCTGGAGTTG
B sequence
ATCGAACCACGGAATCCAACTCCA
AB sequence
TAGCAATCAGGTTGCCTGGAGTTGGATTCC
Marker sequence
GATGCGATTTGGCTATCTGGGTATTGCTATTCAGAGATGAAGGATGCTGT
TACTAGAAGTTGATGTCTTTGTAGTTTAGCTCAGAGGAAGAGAAGGATGG
TTACTAAGATCCTGTTTGTTTCAGTTTTATTCTGCACAGCTCTGTTCTGG
CTAGCAAGTAAGTGAACCATATGAAGACAAAGAAGCGCTTCTTGATTTCC
TTAATAATGTTAATCATTCGCGGTACCTGAATTGGGATGAGAGAACTTCT
GCTTGTAGTTCTTGGACTGGAGTCACTTGTAATCATGAGAAATCAAGAAT
TATAGCAATCAGGTTGCCTGGAGTTGGATTCCGTGGTTCGATTCCTGGAA
ACACTCTTAGCCGCTTGTCTGCTCTTCAGATCTTGAGTTTAAGGTCTAAT
AGTTTTAGTGGCAGTTTACCTACTGATTTTGCAAAACTTGGAAATCTTAC
TTCTATATATCTTCAATCCAATAACTTTCAAGGTCCATTGCCTACTGATT
TTTCTTCTTGGAAAAGCCTTTCGGTTTTGAATTTGTCAAATAATGATTTT
AGTGGGAGTATACCTTCTTCAATATCGAACTTGACTCA
Genomic location of T1388  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1970 marker 1970
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)