SGN Marker solcap_snp_sl_18635

SGN-M19747

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71178)
Chromosome
1
Position
41.11 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67544)
Chromosome
1
Position
33.74 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56078)
Chromosome
1
Position
67.04 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACTCCTTTAAGGGGTATGCCACATTTTTTATTAGATTACCCAGAATATCC
  
3' flanking region
GACAGTCCCTACAAACCCCATTCTAGAAAAAGAAAAGATTCTGAATAAAA
SNP nucleotide
TC
SNPdb format
ACTCCTTTAAGGGGTATGCCACATTTTTTATTAGATTACCCAGAATATCC[T/C]
GACAGTCCCTACAAACCCCATTCTAGAAAAAGAAAAGATTCTGAATAAAA
  
Genomic location of solcap_snp_sl_18635  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19747 marker 19747
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)