SGN Marker solcap_snp_sl_18726

SGN-M19752

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71179)
Chromosome
10
Position
28.94 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67545)
Chromosome
10
Position
41.40 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63942)
Chromosome
10
Position
62.66 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56083)
Chromosome
10
Position
52.87 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CAGTCAGTTCATGATGTTCATTACCAAATGACATGGCGTCCATTGTCTGC
  
3' flanking region
GGGTTGTTGAACAAGGAGAGCTGTGTACGTGCTTCATTTCTTCTTCAATT
SNP nucleotide
AG
SNPdb format
CAGTCAGTTCATGATGTTCATTACCAAATGACATGGCGTCCATTGTCTGC[A/G]
GGGTTGTTGAACAAGGAGAGCTGTGTACGTGCTTCATTTCTTCTTCAATT
  
Genomic location of solcap_snp_sl_18726  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19752 marker 19752
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)