SGN Marker solcap_snp_sl_19068

SGN-M19787

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71200)
Chromosome
1
Position
40.84 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67560)
Chromosome
1
Position
31.22 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56118)
Chromosome
1
Position
38.28 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CAAGGAGCTCATGGAAACATTGCAACGAGCTCTAAAACCCCAGCTTTGAG
  
3' flanking region
AGCAAACGGACCAACTCAAAAAAATTAGTACTAGGTGGGGACAGAATGCT
SNP nucleotide
TC
SNPdb format
CAAGGAGCTCATGGAAACATTGCAACGAGCTCTAAAACCCCAGCTTTGAG[T/C]
AGCAAACGGACCAACTCAAAAAAATTAGTACTAGGTGGGGACAGAATGCT
  
Genomic location of solcap_snp_sl_19068  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19787 marker 19787
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)