SGN Marker solcap_snp_sl_19159

SGN-M19791

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71203)
Chromosome
11
Position
54.98 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67563)
Chromosome
11
Position
56.94 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56122)
Chromosome
11
Position
48.44 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TACTGTTACTGAATTGACCAAGGATAAAAATGCCCGGACAAGATTGCTTG
  
3' flanking region
TTGCATATGCTTGATTGTCATAAGGAACTCTGCTCCTTCTTGCCTTCAAG
SNP nucleotide
TC
SNPdb format
TACTGTTACTGAATTGACCAAGGATAAAAATGCCCGGACAAGATTGCTTG[T/C]
TTGCATATGCTTGATTGTCATAAGGAACTCTGCTCCTTCTTGCCTTCAAG
  
Genomic location of solcap_snp_sl_19159  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19791 marker 19791
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)