SGN Marker solcap_snp_sl_19393

SGN-M19797

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71208)
Chromosome
12
Position
79.44 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67567)
Chromosome
12
Position
92.76 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63958)
Chromosome
12
Position
128.05 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56128)
Chromosome
12
Position
64.48 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTCGTGTGCTTATTGTTTTTCTTCAATAAGGTACTTAGTGTAGTCCAAGC
  
3' flanking region
TATAAAGAAGACACCCTAAATGAGGTGAAACTAGTAAATAAGTTGTGAAC
SNP nucleotide
TG
SNPdb format
GTCGTGTGCTTATTGTTTTTCTTCAATAAGGTACTTAGTGTAGTCCAAGC[T/G]
TATAAAGAAGACACCCTAAATGAGGTGAAACTAGTAAATAAGTTGTGAAC
  
Genomic location of solcap_snp_sl_19393  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19797 marker 19797
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)