SGN Marker T1401

SGN-M1981
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TPTAR69TH
Arabidopsis best BAC match: AC009894.2
Arabidopsis position: 1.1000000
Arabidopsis identities: 0.873
Best GenBank protein hit: AAF02843.1
Evalue: 2.1e-73
Identities: 0.756
Description: Similar to GTP-binding protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39603)
Chromosome
7
Position
95.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39604)
Chromosome
12
Position
52.00 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1401 was used as an overgo probe on plate 4 [well G10]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P227H08,   P207E17,   P207E16,   P073A07,   P207E18,   P005K24,   P007L06,   P108K06,   P066E24,   P016O02,   P215P04,   P221B16

 Overgo Sequences

A sequence
GAATGGCTTGCTCTCAGCTTCTTC
B sequence
GGAATTGCCATGGAAGGAAGAAGC
AB sequence
GAATGGCTTGCTCTCAGCTTCTTCCTTCCA
Marker sequence
GAATAAGCACTTCAACTTGCTAGTGGTAAAATGGCGAGAATGGCTTGCTC
TCAGCTTCTTCCTTCCATGGCAATTCCGCTCAAGTCTTCTTTCCTCAATG
GTTCTTCTCACCAGTGGTTACGACTCTCAGAATCTACGCATCCTGTGGTA
CTCATCAAAAGGCGCTTCTCCGTCGCTAAGATAAGCATGAGTTTGCGAGC
TGGCATCGTTGGCCTTCCTAATGTCGGAAAGTCCACGCTGTTCAACGCCG
TTGTTGAGAATGGAAAGGCTCAGGCTGCTAATTTTCCTTTTTGCACAATA
GAGCCAAATGTAGGGATAGTCGCTGTCCCTGATACACGTCTCCATGTTCT
TTCTGATATAAGCAAATCCAAACGAGCGGTCCCGGCTTCGATAGAGTTTG
TTGATATTGCTGGACTTGTAAAGGGAGCCAGTCAAGGGGAGGGCCTGGGG
AATAAGTTCTTGTCACATATACGTGAAGTGGACTCCATACTTCAGGTAGT
ACGTTGTTTTGAGGACAATGACATTGTTCATGTGAATGGGAAGGTTGAGC
CAAAAGCTGATATTGATGTAATCAACTTGGAATTAATATTCTCAGACTTG
GATCAGATTGAG
Genomic location of T1401  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1981 marker 1981
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)