SGN Marker solcap_snp_sl_19636

SGN-M19824

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67579)
Chromosome
12
Position
72.33 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56155)
Chromosome
12
Position
62.64 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTGATGGAAGTTTTGTCAGAAATCTCGTATTTTCGATCCACGATTTTTT
  
3' flanking region
GTCATGAATTGACTTTTCGGATGTATTTCTGACAGACTTTTCATCGAAAA
SNP nucleotide
CG
SNPdb format
TTTGATGGAAGTTTTGTCAGAAATCTCGTATTTTCGATCCACGATTTTTT[C/G]
GTCATGAATTGACTTTTCGGATGTATTTCTGACAGACTTTTCATCGAAAA
  
Genomic location of solcap_snp_sl_19636  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19824 marker 19824
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)