SGN Marker T1409

SGN-M1985
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAS12TH
Arabidopsis best BAC match: AF013293.1
Arabidopsis position: 4.0030000
Arabidopsis identities: 0.776
Best GenBank protein hit: AAF02785.1
Evalue: 1.8e-68
Identities: 0.798
Description: gene product [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39607)
Chromosome
1
Position
77.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35604
Forward primer (5'-3')
ATGTGATACCTCCGCCGTTA
Digested band sizes (using SacI)
Solanum pennellii LA716: 250
Solanum lycopersicum LA925: 500
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCTTCCATTTCCCAACCA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 500
Solanum lycopersicum LA925: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 10
Forward primer (5'-3')
Unknown
Digested band sizes (using SacI)
Solanum lycopersicum LA925: 500
Solanum pennellii LA716: 250
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 500
Solanum pennellii LA716: 500
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
T1409 was used as an overgo probe on plate 8 [well E9]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TGATCCTCCTTCTCTCTTTCCCTC
B sequence
TACGCAATCGCGATGAGAGGGAAA
AB sequence
TGATCCTCCTTCTCTCTTTCCCTCTCATCG
Marker sequence
GCTTTGTTTTTCTCTGCAATTCACCAAAAATGTCACTTCCAAAATCCAAA
AAATCCTTCCCGTCGGTGACGACATGTGATACCTCCGCCGTTAACCACCA
CTCCGTGGCGGCGGATCTCGACGGAACTCTGTTGATTTCCCGTTCATCTT
TCCCTTACTTCATGCTAGTAGCAATTGAAGCCGGGAGCCTTTTCCGAGGA
CTGATCCTCCTTCTCTCTTTCCCTCTCATCGCGATTGCGTACGTATTTGT
ATCCGAAGCATTAGCTATTCAGATGCTGATTTACATTTCCTTCGCCGGAC
TCAAAGTCCGGGACATTGAGCTCGCTTCGCGAGCTGTTCTCCCGAGATTT
TACGCTACGGATGTTAGGAAGGAGAGTTTCGAGGTTTTCGATCAGTGTAA
GAGGAAAGTTGTGGTTACTGCAAATCCGACTATTATGGTTGAGCCTTTTG
TGAAGGATTTTTTAGGAGGTGATAAAGTACTTGGAACAGAAATCGAGGTG
AATCCGAAGACGAAAAAGGCTACTGGATTTGTGAAGAGTCCTGGGATTTT
GGTTGGGAAATGGAAGAAATTG
Genomic location of T1409  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1985 marker 1985
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)