Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_20088

SGN-M19861

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71238)
Chromosome
3
Position
64.65 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67593)
Chromosome
3
Position
51.95 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63986)
Chromosome
3
Position
58.38 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56192)
Chromosome
3
Position
55.72 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AATATCAGCCGCGCGAACCCAGAACTGAAAAGACCGTTGCCAAGGTCGGA
  
3' flanking region
CTGAGTAGAGACCTTTTCTTGAAACTCTTTGAGATCAAAATGGAATAGCA
SNP nucleotide
AG
SNPdb format
AATATCAGCCGCGCGAACCCAGAACTGAAAAGACCGTTGCCAAGGTCGGA[A/G]
CTGAGTAGAGACCTTTTCTTGAAACTCTTTGAGATCAAAATGGAATAGCA
  
Genomic location of solcap_snp_sl_20088  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19861 marker 19861
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)